Remove Adaptor and Low-Quality Reads with Trimmomatic

Removing adapters and low-quality sequences from sequencing data is essential for ensuring data accuracy and quality. Most sequencers employ a sequencing adapter to generate raw data; however, these artificial sequences must be removed during data processing. This not only eliminates the adapter but also improves the overall quality of the data by removing errors or low-quality read ends that may occur during the sequencing process. Trimmomatic, a multithreaded tool based on the JavaScript platform, is highly effective in performing these tasks, making it a valuable resource in bioinformatics for obtaining high-quality data. This protocol was created based on Trimmomatic version 0.39 running on a system equipped with an Intel 10th generation i9-10910 processor and 48GB of memory. The test environment includes Python version 3.8.5 and Java version 16.0.1 under macOS 12.4 environment.

Installation Trimmomatic

Download the file from the official website and unzip it to a folder of your choice.

Requirments

To run Trimmomatic, you need Java version 7 or higher. Use the following command to check Java version:

  $ java -version
  java version "16.0.1" 2020-04-20
  Java(TM) SE Runtime Environment (build 16.0.1+9-24)
  Java HotSpot(TM) 64-Bit Server VM (build 16.0.1+9-24, mixed mode, sharing)

Running Trimmomatic

Use the following command to perform Trimmomatic via Java machine: Trimmomatic and its related command-lines must be typed in directory of trimmomatic.

$ java -var Trimmomatic-0.39.jar <mode> -<score> -threads <int> <input1> ... <inputN> \
	<PairedOutput1.fq.gz> <UnpairOutput1.fq.gz> ... <PairedOutputN.fq.gz> <UnpairOutputN.fq.gz> \
	<OptionalParameters>

# e.g. Full commands for pair-end mode
$ java -var Trimmomatic-0.39.jar <mode> -<score> -threads <int> <input1> <input2> \
	<PairedOutput1.fq.gz> <UnpairOutput1.fq.gz> <PairedOutput2.fq.gz> <UnpairOutput2.fq.gz> \
	ILLUMINACLIP:[adaptor file.fa]:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 

# e.g. Full commands for single-end mode
$ java -var Trimmomatic-0.39.jar <mode> -<score> -threads <int> <input1> <PairedOutput1.fq.gz> \
	ILLUMINACLIP:[adaptor file.fa]:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 

In these commands:

Parameter	Description
`java -var Trimmomatic-0.39.jar`	Executes `trimmomatic` code
`<mode>` option	Specifies sequence type from either pair-end (`PE`) or single-end (`SE`)
`-<score>` option	Determines quality score whether this score is based on 33 (`phred33`) or 64 (`phred64`).
`-threads <int>`	Specifies thread numbers for this operation.
`<input1> ... <inputN>`	Specifies forward and reverse input files, they are separated by spaces.
`<PairedOutputN.fq.gz> <UnpairOutputN.fq.gz>`	Specifies output files. In `PE` mode, each input file will result in the creation of two output files, arranged in the specific order of “pair” and “unpair”. It is imperative to preserve this order to prevent any discrepancies. In `SE` mode, each input file will generate a single output file, irrespective of any pairing configuration.

The <OptionalParameters> offer a wide range of variables as bellow, see the Trimmomatic’s manual for details (For more information such as global parameter, refers to Trimmomatic’s guidelines.).

Parameter	Description
`ILLUMINACLIP:<path/to/CLIP.fa>`	Specifies a adaptor clip file. Trimmomtic provide this universal sequence clip in `/adapters` folder. `ILLUMINACLIP` would be assigned relative path.
`:<seed mismatches>:<palindrome clip threshold>:<simple clip threshold>`	Specifies the maximum mismatch, how accurate the match between the two adapter ligated reads, and how accurate the match between any adapter, respectively. This parameter should come after the `ILLUMINACLIP`, most commonly `:2:30:10`.
`LEADING:<quality>`	Remove low quality bases from the beginning. Specifies the minimum quality required to keep a base, most commonly `LEADING:3`.
`TRAILING:<quality>`	Remove low quality bases from the end. Specifies the minimum quality required to keep a base, most commonly `TRAILING:3`
`SLIDINGWINDOW:<size:<quality>`	Perform a sliding window trimming, cutting once the average quality (`quality`) within the window (`size`)falls below a threshold, most commonly `SLIDINGWINDOW:4:15`.
`MINLEN:<length>`	This module removes reads that fall below the specified minimal length. Specifies the minimum length of reads to be kept, most commonly `MINLEN:36`.

Example Code with explanation

Here is an example command with footnote for explanation to perform Trimmomatic on QCed fastq files:

# Example for PE mode
java -jar trimmomatic-0.39.jar PE -threads 20 -phred33 \ # Run a Trimmomatic, consist pair-end and base on ASCII 33, using 20 threads.
	~/Desktop/Bone_fastq/shC_D0_1.fastq.gz ~/Desktop/Bone_fastq/shC_D0_2.fastq.gz \ # Speficies forward and reverse input files, respectively.		
	~/Desktop/Bone_Trim/Trim_shC_D0_1.fastq.gz ~/Desktop/Bone_Trim/unTrim_shC_D0_1.fastq.gz \ # Output for forward
	~/Desktop/Bone_Trim/Trim_shC_D0_2.fastq.gz ~/Desktop/Bone_Trim/unTrim_shC_D0_2.fastq.gz \ # Output for reverse
	ILLUMINACLIP:adapters/TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 # Specify adaptor sequence and global parameters

# Example for SE mode
java -jar trimmomatic-0.39.jar SE -threads 20 -phred33 \ # Run a Trimmomatic with SE mode
	~/Desktop/ChIP_seq/H3K4me3.fastq.gz TRIM_H3K4me3.fq.gz \ # Input and ouput
	ILLUMINACLIP:adapters/TruSeq3-SE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36 # global parameters

Output

When Trimmomatic finishes running, it prints messages summarizing what happened.

	TrimmomaticPE: Started with arguments:
 	-threads 20 -phred33 /Users/jchoi/Desktop/Bone_fastq/shC_D0_1.fastq.gz /Users/jchoi/Desktop/Bone_fastq/shC_D0_2.fastq.gz /Users/jchoi/Desktop/Bone_Trim/Trim_shC_D0_1.fastq.gz /Users/jchoi/Desktop/Bone_Trim/unTrim_shC_D0_1.fastq.gz /Users/jchoi/Desktop/Bone_Trim/Trim_shC_D0_2.fastq.gz /Users/jchoi/Desktop/Bone_Trim/unTrim_shC_D0_2.fastq.gz ILLUMINACLIP:adapters/TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
	Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
	ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
	Input Read Pairs: 41429555 Both Surviving: 40573408 (97.93%) Forward Only Surviving: 646381 (1.56%) Reverse Only Surviving: 168217 (0.41%) Dropped: 41549 (0.10%)
	TrimmomaticPE: Completed successfully

Citation

Trimmomatic

Bolger, A. M., Lohse, M., & Usadel, B. (2014). Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics, 30(15), 2114-2120. DOI